FastAmp® Plant Direct PCR/Genotyping Solution is designed for rapid cell lysis and DNA separation simultaneously without the need for DNA extraction steps. It contains very low concentrations of less toxic chemicals for direct DNA amplification of genomic DNA from various plant tissues. No heat treatment and no termination buffer is is required, saving significant time. FastAmp® Plant Direct PCR/Genotyping Solution has been optimized with FastAmp® Plant Direct PCR kit and FastAmp® Plant Tissue/Seed Genotyping PCR kit.
Highlights
- Simple DNA Preparation—No DNA extraction is needed
- Fast Protocol—Tissue lysis/Genomic DNA ready for PCR in 3 min
- Contains non-toxic solutions for lysis and DNA preparation
- Simple to use for single tube Multiplexing (single tube, tube strips, 96-well, or 384-well )
- Save significant time and funding (no bead or spin column, minimal hands-on time )
- Consistent results
Product Includes
- FastAmp® Plant Direct PCR/Genotyping Solution
Storage TemperatureRoom Temperature
Quality Control Assays
FastAmp® Plant Direct PCR/Genotyping Solution has been tested via Direct PCR analysis from various plant tissues, some of the results are included here. QC Data from various tissue below:
Lane 1: 25µl Buffer/5mmx5mm Leaf TissueLane 2: 25µl Buffer/5mmx5mm Leaf TissueLane 3: 25µl Buffer/5mmx5mm Leaf TissueLane 4: 25µl Buffer/5mmx5mm Leaf TissueControl Primer F – AGTTCGAGCCTGATTATCCCControl Primer R – GCATGCCGCCAGCGTTCATC
Technical Support
Intact Genomics is committed to supporting the worldwide scientific research community by supplying the highest quality reagents. Each new lot of our products is tested to ensure they meet the quality standards and specifications designated for the product. Please follow the instructions carefully and contact us if additional assistance is needed. We appreciate your business and your feedback regarding the performance of our products in your applications.
